Prostaglandin F2 alpha Receptor (PTGFR) (NM_001039585) Human Untagged Clone

CAT#: SC310785

PTGFR (untagged)-Human prostaglandin F receptor (FP) (PTGFR), transcript variant 2



  "NM_001039585" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PTGFR Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310785 representing NM_001039585.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCATGAACAATTCCAAACAGCTAGTGTCTCCTGCAGCTGCGCTTCTTTCAAACACAACCTGCCAG
ACGGAAAACCGGCTTTCCGTATTTTTTTCAGTAATCTTCATGACAGTGGGAATCTTGTCAAACAGCCTT
GCCATCGCCATTCTCATGAAGGCATATCAGAGATTTAGACAGAAGTCCAAGGCATCGTTTCTGCTTTTG
GCCAGTGGCCTGGTAATCACTGATTTCTTTGGCCATCTCATCAATGGAGCCATAGCAGTATTTGTATAT
GCTTCTGATAAAGAATGGATCCGCTTTGACCAATCAAATGTCCTTTGCAGTATTTTTGGTATCTGCATG
GTGTTTTCTGGTCTGTGCCCACTTCTTCTAGGCAGTGTGATGGCCATTGAGCGGTGTATTGGAGTCACA
AAACCAATATTTCATTCTACGAAAATTACATCCAAACATGTGAAAATGATGTTAAGTGGTGTGTGCTTG
TTTGCTGTTTTCATAGCTTTGCTGCCCATCCTTGGACATCGAGACTATAAAATTCAGGCGTCGAGGACC
TGGTGTTTCTACAACACAGAAGACATCAAAGACTGGGAAGATAGATTTTATCTTCTACTTTTTTCTTTT
CTGGGGCTCTTAGCCCTTGGTGTTTCATTGTTGTGCAATGCAATCACAGGAATTACACTTTTAAGAGTT
AAATTTAAAAGTCAGCAGCACAGACAAGGCAGATCTCATCATTTGGAAATGGTAATCCAGCTCCTGGCG
ATAATGTGTGTCTCCTGTATTTGTTGGAGCCCATTTCTGGGATACAGAATAATTTTGAATGGGAAAGAG
AAATATAAAGTATATGAAGAGCAAAGTGATTTCTTACATAGGTTACAATGGCCAACATTGGAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001039585
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001039585.1
RefSeq Size 5431 bp
RefSeq ORF 894 bp
Locus ID 5737
UniProt ID P43088
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
MW 33.7 kDa
Gene Summary The protein encoded by this gene is member of the G-protein coupled receptor family. This protein is a receptor for prostaglandin F2-alpha (PGF2-alpha), which is known to be a potent luteolytic agent, and may also be involved in modulating intraocular pressure and smooth muscle contraction in uterus. Knockout studies in mice suggest that the interaction of PGF2-alpha with this receptor may initiate parturition in ovarian luteal cells and thus induce luteolysis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) contains an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Prostaglandin F2 alpha Receptor产品

Customer Reviews 
Loading...