MDH2 (NM_005918) Human Untagged Clone
CAT#: SC320052
MDH2 (untagged)-Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein
CNY 2,950.00
Cited in 1 publication. |
Product images
CNY 6,281.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DEE51; EIEE51; M-MDH; MDH; MGC:3559; MOR1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_005918.2
GCCAGTCGGTGCCCCTCCCGCTCCAGCCATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGC
TGCTCTCCGCCGCAGCTTCAGCACCTCGGCCCAGAACAATGCTAAAGTAGCTGTGCTAGG GGCCTCTGGAGGCATCGGGCAGCCACTTTCACTTCTCCTGAAGAACAGCCCCTTGGTGAG CCGCCTGACCCTCTATGATATCGCGCACACACCCGGAGTGGCCGCAGATCTGAGCCACAT CGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGACCTGAACAGCTGCCTGACTGCCTGAA AGGTTGTGATGTGGTAGTTATTCCGGCTGGAGTCCCCAGAAAGCCAGGCATGACCCGGGA CGACCTGTTCAACACCAATGCCACGATTGTGGCCACCCTGACCGCTGCCTGTGCCCAGCA CTGCCCGGAAGCCATGATCTGCGTCATTGCCAATCCGGTTAATTCCACCATCCCCATCAC AGCAGAAGTTTTCAAGAAGCATGGAGTGTACAACCCCAACAAAATCTTCGGCGTGACGAC CCTGGACATCGTCAGAGCCAACACCTTTGTTGCAGAGCTGAAGGGTTTGGATCCAGCTCG AGTCAACGTCCCTGTCATTGGTGGCCATGCTGGGAAGACCATCATCCCCCTGATCTCTCA GTGCACCCCCAAGGTGGACTTTCCCCAGGACCAGCTGACAGCACTCACTGGGCGGATCCA GGAGGCCGGCACGGAGGTGGTCAAGGCTAAAGCCGGAGCAGGCTCTGCCACCCTCTCCAT GGCGTATGCCGGCGCCCGCTTTGTCTTCTCCCTTGTGGATGCAATGAATGGAAAGGAAGG TGTTGTGGAATGTTCCTTCGTTAAGTCACAGGAAACGGAATGTACCTACTTCTCCACACC GCTGCTGCTTGGGAAAAAGGGCATCGAGAAGAACCTGGGCATCGGCAAAGTCTCCTCTTT TGAGGAGAAGATGATCTCGGATGCCATCCCCGAGCTGAAGGCCTCCATCAAGAAGGGGGA AGATTTCGTGAAGACCCTGAAGTGAGCCGCTGTGACGGGTGGCCAGTTTCCTTAATTTAT GAAGGCATCATGTCACTGCAAAGCCGTTGCAGATAAACTTTGTATTTTAATTTGCTTTGG TGATGATTACTGTATTGACATCATCATGCCTTCCAAATTGTGGGTGGCTCTGTGGGCGCA TCAATAAAAGCCGTCCTTGATTTTAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_005918 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005918.2, NP_005909.2 |
RefSeq Size | 1321 bp |
RefSeq ORF | 1017 bp |
Locus ID | 4191 |
UniProt ID | P40926 |
Domains | ldh |
Protein Families | Druggable Genome |
Protein Pathways | Citrate cycle (TCA cycle), Glyoxylate and dicarboxylate metabolism, Metabolic pathways, Pyruvate metabolism |
Gene Summary | Malate dehydrogenase catalyzes the reversible oxidation of malate to oxaloacetate, utilizing the NAD/NADH cofactor system in the citric acid cycle. The protein encoded by this gene is localized to the mitochondria and may play pivotal roles in the malate-aspartate shuttle that operates in the metabolic coordination between cytosol and mitochondria. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Whole-Exome Sequencing Identifies MDH2 as a New Familial Paraganglioma Gene
,Cascón, A;Comino-Méndez, I;Currás-Freixes, M;de Cubas, AA;Contreras, L;Richter, S;Peitzsch, M;Mancikova, V;Inglada-Pérez, L;Pérez-Barrios, A;Calatayud, M;Azriel, S;Villar-Vicente, R;Aller, J;Setién, F;Moran, S;Garcia, JF;Río-Machín, A;Letón, R;Gómez-Graña, Á;Apellániz-Ruiz, M;Roncador, G;Esteller, M;Rodríguez-Antona, C;Satrústegui, J;Eisenhofer, G;Urioste, M;Robledo, M;,
J. Natl. Cancer Inst.
,PubMed ID 25766404
[MDH2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201095 | MDH2 (Myc-DDK-tagged)-Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein |
CNY 3,656.00 |
|
RC201095L1 | Lenti ORF clone of Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201095L2 | Lenti ORF clone of Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RC201095L3 | Lenti ORF clone of Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201095L4 | Lenti ORF clone of Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RG201095 | MDH2 (tGFP-tagged) - Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein |
CNY 4,370.00 |