United States
Germany
Japan
United Kingdom
China
MTHFS (NM_006441) Human Untagged Clone
CAT＃: SC322547
MTHFS (untagged)-Human 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS), transcript variant 1
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HsT19268; NEDMEHM |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC322547
AGACCGAACCCGAGGGCGCCCAGGGCGCCGAGGGCGGGACTGGACTCGGCTTGGGCGTGA
GATGGCGGCGGCAGCGGTGAGCAGCGCCAAGCGTAGCCTGCGGGGAGAGCTGAAGCAGCG TCTGCGGGCGATGAGTGCCGAGGAGCGGCTACGCCAGTCCCGCGTACTGAGCCAGAAGGT GATTGCCCACAGTGAGTATCAAAAGTCCAAAAGAATTTCCATCTTTCTGAGCATGCAAGA TGAAATTGAGACAGAAGAGATCATCAAGGACATTTTCCAACGAGGCAAAATCTGCTTCAT CCCTCGGTACCGGTTCCAGAGCAATCACATGGATATGGTGAGAATAGAATCACCAGAGGA AATTTCTTTACTTCCCAAAACATCCTGGAATATCCCTCAGCCTGGTGAGGGTGATGTTCG GGAGGAGGCCTTGTCCACAGGGGGACTTGATCTCATCTTCATGCCAGGCCTTGGGTTTGA CAAACATGGCAACCGACTGGGGAGGGGCAAGGGCTACTATGATGCCTATCTGAAGCGCTG TTTGCAGCATCAGGAAGTGAAGCCCTACACCCTGGCGTTGGCTTTCAAAGAACAGATTTG CCTCCAGGTCCCAGTGAATGAAAACGACATGAAGGTAGATGAAGTCCTTTACGAAGACTC GTCAACAGCTTAAATCTGGATTACTACAGCCAAATAATCAGTGTTTTATATGAGAGTAAA GCAAAGTATGTGTATTTTTCCCTTGTCAAAAATTAGTTGAAATTGTTCATTAATGTGAAT ACAGACTGCATTTTAAAATTGTAATTATGAAATACCTTATATAAAACCATCTTTAAAAAC CAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_006441 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_006441.1, NP_006432.1 |
| RefSeq Size | 857 bp |
| RefSeq ORF | 612 bp |
| Locus ID | 10588 |
| UniProt ID | P49914 |
| Domains | 5-FTHF_cyc-lig |
| Protein Pathways | Metabolic pathways, One carbon pool by folate |
| Gene Summary | The protein encoded by this gene is an enzyme that catalyzes the conversion of 5-formyltetrahydrofolate to 5,10-methenyltetrahydrofolate, a precursor of reduced folates involved in 1-carbon metabolism. An increased activity of the encoded protein can result in an increased folate turnover rate and folate depletion. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2011] Transcript Variant: This variant (1) encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205749 | MTHFS (Myc-DDK-tagged)-Human 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS), transcript variant 1 |
CNY 2,400.00 |
|
| RC205749L3 | Lenti ORF clone of Human 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC205749L4 | Lenti ORF clone of Human 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG205749 | MTHFS (tGFP-tagged) - Human 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS), transcript variant 1 |
CNY 4,000.00 |
|
| SC116123 | MTHFS (untagged)-Human 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS), transcript variant 1 |
CNY 2,400.00 |
