United States
Germany
Japan
United Kingdom
China
alpha Sarcoglycan (SGCA) (NM_001135697) Human Untagged Clone
CAT＃: SC325682
SGCA (untagged)-Human sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein) (SGCA), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 50DAG; adhalin; ADL; DAG2; DMDA2; LGMD2D; LGMDR3; SCARMD1 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001135697, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAGACACTCTTCTGGACTCCTCTCCTCGTGGTTCTCCTGGCAGGGCTGGGGGAC ACCGAGGCCCAGCAGACCACGCTACACCCACTTGTGGGCCGTGTCTTTGTGCACACCTTG GACCATGAGACGTTTCTGAGCCTTCCTGAGCATGTCGCTGTCCCACCCGCTGTCCACATC ACCTACCACGCCCACCTCCAGGGACACCCAGACCTGCCCCGGTGGCTCCGCTACACCCAG CGCAGCCCCCACCACCCTGGCTTCCTCTACGGCTCTGCCACCCCAGAAGATCGTGGGCTC CAGGTCATTGAGGTCACAGCCTACAATCGGGACAGCTTTGATACCACTCGGCAGAGGCTG GTGCTGGAGATTGGGGACCCAGAAGGCCCCCTGCTGCCATACCAAGCCGAGTTCCTGGTG CGCAGCCACGATGCGGAGGAGGTGCTGCCCTCAACACCTGCCAGCCGCTTCCTCTCAGCC TTGGGGGGACTCTGGGAGCCCGGAGAGCTTCAGCTGCTCAACGTCACCTCTGCCTTGGAC CGTGGGGGCCGTGTCCCCCTTCCCATTGAGGGCCGAAAAGAAGGGCTGAAGAGAGACCTG GCTACCTCCGACATCCAGATGGTCCACCACTGCACCATCCACGGGAACACAGAGGAGCTG CGGCAGATGGCGGCCAGCCGCGAGGTGCCCCGGCCACTCTCCACCCTGCCCATGTTCAAT GTGCACACAGGTGAGCGGCTGCCTCCCCGCGTGGACAGCGCCCAGGTGCCCCTCATTCTG GACCAGCAC |
| Restriction Sites | Please inquire |
| ACCN | NM_001135697 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001135697.1, NP_001129169.1 |
| RefSeq Size | 1069 bp |
| RefSeq ORF | 792 bp |
| Locus ID | 6442 |
| UniProt ID | Q16586 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), Viral myocarditis |
| Gene Summary | This gene encodes a component of the dystrophin-glycoprotein complex (DGC), which is critical to the stability of muscle fiber membranes and to the linking of the actin cytoskeleton to the extracellular matrix. Its expression is thought to be restricted to striated muscle. Mutations in this gene result in type 2D autosomal recessive limb-girdle muscular dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (2) lacks two alternate in-frame exons in the central coding region, compared to variant 1. The resulting isoform (2) lacks a segment of the sarcoglycan domain including the transmembrane domain, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227929 | SGCA (Myc-DDK-tagged)-Human sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein) (SGCA), transcript variant 2 |
CNY 3,990.00 |
|
| RC227929L3 | Lenti-ORF clone of SGCA (Myc-DDK-tagged)-Human sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein) (SGCA), transcript variant 2 |
CNY 5,890.00 |
|
| RC227929L4 | Lenti-ORF clone of SGCA (mGFP-tagged)-Human sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein) (SGCA), transcript variant 2 |
CNY 5,890.00 |
|
| RG227929 | SGCA (tGFP-tagged) - Human sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein) (SGCA), transcript variant 2 |
CNY 4,370.00 |
