United States
Germany
Japan
United Kingdom
China
ARP10 (APOBEC3H) (NM_001166003) Human Untagged Clone
CAT＃: SC326767
APOBEC3H (untagged)-Human apolipoprotein B mRNA editing enzyme catalytic polypeptide-like 3H (APOBEC3H) transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | A3H; ARP-10; ARP10 |
| Vector | PCMV6-Neo |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001166003 edited
ATGGCTCTGTTAACAGCCGAAACATTCCGCTTACAGTTTAACAACAAGCGCCGCCTCAGA AGGCCTTACTACCCGAGGAAGGCCCTCTTGTGTTACCAGCTGACGCCGCAGAATGGCTCC ACGCCCACGAGAGGCTACTTTGAAAACAAGAAAAAGTGCCATGCAGAAATTTGCTTTATT AACGAGATCAAGTCCATGGGACTGGACGAAACGCAGTGCTACCAAGTCACCTGTTACCTC ACGTGGAGCCCCTGCTCCTCCTGTGCCTGGGAGCTGGTTGACTTCATCAAGGCTCACGAC CATCTGAACCTGGGCATCTTCGCCTCCCGCCTGTACTACCACTGGTGCAAGCCCCAGCAG AAGGGGCTGCGGCTTCTGTGTGGATCCCAGGTCCCGGTGGAGGTCATGGGCTTCCCAAAG TTTGCTGACTGCTGGGAAAACTTTGTGGACCACGAGAAACCGCTTTCCTTCAACCCCTAT AAGATGTTAGAGGAGCTAGATAAAAACAGTCGAGCCATAAAGCGACGGCTTGAGAGGATA AAGATTCCAGGGGTACGTGCGCAGGGTCGTTACATGGATATATTGTGTGATGCTGAGGTC TGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001166003 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001166003.1, NP_001159475.1 |
| RefSeq Size | 1164 bp |
| RefSeq ORF | 603 bp |
| Locus ID | 164668 |
| UniProt ID | Q6NTF7 |
| Gene Summary | This gene encodes a member of the apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3 family of proteins. The encoded protein is a cytidine deaminase that has antiretroviral activity by generating lethal hypermutations in viral genomes. Polymorphisms and alternative splicing in this gene influence its antiretroviral activity and are associated with increased resistence to human immunodeficiency virus type 1 infection in certain populations. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009] Transcript Variant: This variant (SV-200) represents the longest transcript and encodes the longest isoform (SV-200). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228132 | APOBEC3H (Myc-DDK-tagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H (APOBEC3H), transcript variant 1 |
CNY 2,400.00 |
|
| RC228132L1 | Lenti ORF clone of Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H (APOBEC3H), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC228132L2 | Lenti ORF clone of Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H (APOBEC3H), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC228132L3 | Lenti ORF clone of Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H (APOBEC3H), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC228132L4 | Lenti ORF clone of Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H (APOBEC3H), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
| RG228132 | APOBEC3H (tGFP-tagged) - Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H (APOBEC3H), transcript variant 1 |
CNY 4,370.00 |
