PARVB (NM_001243385) Human Untagged Clone

CAT#: SC331997

PARVB (untagged) - Homo sapiens parvin, beta (PARVB), transcript variant 3



  "NM_001243385" in other vectors (2)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PARVB mouse monoclonal antibody,clone OTI1B7
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-56
Vector pCMV6-Entry
Sequence Data
>SC331997 representing NM_001243385.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGTGACCTGCAGGAAGAAGGCAAGAATGCCATCAACTCACCGATGTCCCCCGCCCTGGTGGATGTT
CACCCTGAAGACACCCAGCTTGAGGAGAACGAGGAGCGCACGATGATTGACCCCACTTCCAAGGAAGAC
CCCAAGTTCAAGGAACTGGTCAAGGTCCTCCTCGACTGGATTAATGACGTGCTGGTGGAGGAGAGGATC
ATTGTGAAGCAGCTGGAGGAAGACCTGTATGACGGCCAGGTGCTGCAGAAGCTCTTGGAAAAACTGGCA
GGGTGCAAGCTGAATGTGGCTGAGGTGACACAGTCCGAAATAGGGCAGAAACAGAAGCTGCAGACGGTG
CTGGAAGCAGTACATGACCTGCTGCGGCCCCGAGGCTGGGCGCTCCGGTGGAGCGTGGACTCAATTCAC
GGGAAGAACCTGGTGGCCATCCTCCACCTGCTGGTCTCTCTGGCCATGCACTTCAGGGCCCCCATCCGC
CTTCCTGAGCATGTAACGGTGCAGGTGGTGGTCGTGCGGAAACGGGAAGGCCTGCTGCATTCCAGCCAC
ATCTCGGAGGAGCTGACCACAACTACAGAGATGATGATGGGCCGGTTCGAGCGGGATGCCTTCGACACG
CTGTTCGACCACGCCCCGGATAAGCTCAGCGTGGTGAAGAAGTCTCTCATCACTTTTGTGAACAAGCAC
CTGAACAAGCTGAATTTGGAGGTGACGGAACTGGAGACCCAGTTTGCAGATGGCGTGTACCTGGTTCTG
CTCATGGGCCTTCTGGAAGACTACTTTGTTCCTCTCCACCACTTCTACCTGACTCCGGAAAGCTTCGAT
CAGAAGGTCCACAATGTGTCCTTCGCCTTTGAGCTGATGCTGGACGGAGGCCTCAAGAAACCCAAGGCT
CGTCCTGAAGACGTGGTTAACTTGGACCTCAAATCCACCCTGAGGGTTCTTTACAACCTGTTCACCAAG
TACAAGAACGTGGAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243385
Insert Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243385.1
RefSeq Size 1596 bp
RefSeq ORF 984 bp
Locus ID 29780
UniProt ID Q9HBI1
Protein Pathways Focal adhesion
MW 37.5 kDa
Gene Summary This gene encodes a member of the parvin family of actin-binding proteins, which play a role in cytoskeleton organization and cell adhesion. These proteins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. This family member binds to alphaPIX and alpha-actinin, and it can inhibit the activity of integrin-linked kinase. This protein also functions in tumor suppression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream alternate start codon, compared to variant 1. The resulting isoform (c) is shorter at the N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...