KCNMA1 (NM_001271520) Human Untagged Clone

CAT#: SC333061

KCNMA1 (untagged) - Homo sapiens potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (KCNMA1), transcript variant 7



  "NM_001271520" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-KCNMA1 Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA205K10.1; BKTM; CADEDS; hSlo; IEG16; KCa1.1; LIWAS; MaxiK; mSLO1; PNKD3; SAKCA; SLO; SLO-ALPHA; SLO1
Vector pCMV6-Entry
Sequence Data
>SC333061 representing NM_001271520.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAAATGGTGGCGGCGGCGGCGGCGGCAGCAGCGGCGGCGGCGGCGGCGGCGGAGGCAGCAGTCTT
AGAATGAGTAGCAATATCCACGCGAACCATCTCAGCCTAGACGCGTCCTCCTCCTCCTCCTCCTCCTCT
TCCTCTTCTTCTTCTTCCTCCTCCTCTTCCTCCTCGTCCTCGGTCCACGAGCCCAAGATGGATGCGCTC
ATCATCCCGGTGACCATGGAGGTGCCGTGCGACAGCCGGGGCCAACGCATGTGGTGGGCTTTCCTGGCC
TCCTCCATGGTGACTTTCTTCGGGGGCCTCTTCATCATCTTGCTCTGGCGGACGCTCAAGTACCTGTGG
ACCGTGTGCTGCCACTGCGGGGGCAAGACGAAGGGTTGTTGGCGGCTGCGGCTGGGGCCGGGGTCGGGG
ACTCACAGGCTCGGGTGCCGTGGTGCGGGGTGGGGACAGCCAACTCAGCGGGGACGGAGGAAGCTGGGG
GCAGCTGGGTGCGTGTTTTGCACCGCTCACCTGCCGGGGCTCGGCTCCTGGCGGTGGGCGAGAGGGAGC
ACATCCGCCCATACTTTAGGAACCTGTTGGGGAGATGAGTTCGTGGGGTCAGAAAGAAGGGAAAAATCC
TTTGGGCAAGGGAGAGAATAA

Restriction Sites SgfI-RsrII     
ACCN NM_001271520
Insert Size 642 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271520.1
RefSeq Size 1385 bp
RefSeq ORF 642 bp
Locus ID 3778
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Protein Pathways Vascular smooth muscle contraction
MW 22.2 kDa
Gene Summary MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (7) is a two-exon transcript with a distinct 3' UTR compared to variant 1. The predicted protein (short1) has a distinct C-terminus and is significantly shorter than isoform a. It is unknown if this protein is stable or has any function.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...