HDDC3 (NM_001286451) Human Untagged Clone
CAT#: SC334209
HDDC3 (untagged) - Human HD domain containing 3 (HDDC3), transcript variant 1
CNY 3,840.00
货期*
现货
规格
Cited in 2 publications. |
Product images
经常一起买 (3)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | (ppGpp)ase; MESH1 |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286451, the custom clone sequence may differ by one or more nucleotides
ATGGGCTCTGAGGCGGCGCAGCTGCTGGAGGCTGCCGACTTCGCGGCTCGCAAGCACCGGCAGCAGCGGC GGAAGGACCCCGAGGGGACCCCCTACATCAACCACCCCATCGGTGTGGCACGGATCCTGACCCACGAGGC GGGAATCACTGACATTGTGGTGTTACAGGCGGCCCTGCTCCATGACACGGTGGAGGACACAGACACCACC CTGGATGAGGTGGAGCTACACTTTGGGGCACAAGTGCGGCGCCTGGTGGAGGAGGTAACAGATGACAAGA CTCTGCCCAAGCTGGAGAGAAAGAGGCTGCAGGTGGAGCAAGCGCCCCACAGTAGCCCCGGGGCCAAACT GGTGAAGCTGGCAGACAAGCTGTACAATCTGAGGGACCTGAATCGCTGCACCCCAGAGGGATGGTCAGAA CATCGAGTCCAGGAATACTTCGAGTGGGCAGCGCAGGTGGTGAAGGGGCTTCAGGGAACAAACCGGCAAC TGGAAGAGGCTCTAAAGCATCTGTTCAAGCAGCGGGGGCTGACAATCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286451 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001286451.1, NP_001273380.1 |
RefSeq Size | 942 bp |
RefSeq ORF | 540 bp |
Locus ID | 374659 |
UniProt ID | Q8N4P3 |
Gene Summary | ppGpp hydrolyzing enzyme involved in starvation response.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the shortest transcript and encodes the longer isoform (1). |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
MESH1 is a cytosolic NADPH phosphatase that regulates ferroptosis
,Ding, C;Rose, J;Sun, T;Wu, J;Chen, P;Lin, C;Yang, W;Chen, K;Lee, H;Xu, E;Tian, S;Akinwuntan, J;Zhao, J;Guan, Z;Zhou, P;Chi, J;,
Nat Metab
[HDDC3]
|
MESH1 is a cytosolic NADPH phosphatase that regulates ferroptosis
,null,
Nature metabolism
,PubMed ID 32462112
[HDDC3]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...