Human GBA activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	GBA
Locus ID	2629
Kit Components	GA101750G1, GBA gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTGAACGAACAAGTGTCGC GA101750G2, GBA gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCCCTTCCTCAAGTCTCAT GA101750G3, GBA gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGACGGTCACTCATGCAG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000157, NM_001005741, NM_001005742, NM_001005749, NM_001005750, NM_001171811, NM_001171812
Synonyms	GBA1; GCB; GLUC
Summary	This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.