B3GAT2 (NM_080742) Human Untagged Clone

CAT#: SC312951

B3GAT2 (untagged)-Human beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) (B3GAT2)



  "NM_080742" in other vectors (4)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GLCATS
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_080742 edited
ATGAAGTCCGCGCTTTTCACCCGCTTCTTTATCCTCCTGCCCTGGATCCTAATTGTCATC
ATCATGCTCGACGTGGACACGCGCAGGCCAGTGCCCCCGCTCACCCCGCGCCCCTACTTC
TCTCCCTACGCGGTGGGCCGCGGGGGCGCCCGACTCCCGCTCCGCAGGGGCGGCCCGGCT
CACGGGACCCAAAAGCGCAACCAGTCTCGGCCGCAGCCACAGCCGGAGCCGCAGCTGCCC
ACCATCTATGCCATCACGCCCACCTACAGCCGCCCGGTGCAGAAAGCGGAGCTGACCCGC
CTGGCCAACACGTTCCGCCAGGTGGCGCAGCTGCACTGGATCCTGGTGGAGGACGCGGCG
GCGCGCAGCGAGCTGGTGAGCCGCTTCCTGGCGCGGGCCGGGCTGCCCAGCACTCACCTG
CACGTGCCCACGCCGCGGCGCTACAAGCGGCCCGGGCTGCCGCGCGCCACTGAGCAGCGC
AACGCGGGCCTCGCCTGGCTGCGCCAGAGGCACCAGCACCAGCGCGCGCAGCCCGGCGTG
CTCTTCTTCGCTGACGACGACAACACCTATAGTCTGGAGCTCTTCCAGGAGATGCGAACC
ACCCGCAAGGTCTCCGTCTGGCCTGTGGGCCTGGTTGGTGGGCGGCGCTACGAACGTCCG
CTGGTGGAAAACGGCAAAGTTGTTGGCTGGTACACCGGCTGGAGAGCAGACAGGCCTTTT
GCCATCGACATGGCAGGATTTGCTGTAAGTCTTCAAGTCATTTTGTCCAATCCAAAAGCT
GTATTTAAGCGTCGTGGATCCCAGCCAGGGATGCAAGAATCTGACTTTCTCAAACAGATA
ACAACAGTCGAAGAACTGGAACCGAAAGCAAATAACTGCACTAAGGTTCTCGTGTGGCAC
ACTCGGACAGAGAAGGTTAATCTAGCCAACGAGCCAAAGTACCACCTGGACACAGTGAAA
ATTGAGGTATAA
Restriction Sites Please inquire     
ACCN NM_080742
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_080742.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_080742.1, NP_542780.1
RefSeq Size 972 bp
RefSeq ORF 972 bp
Locus ID 135152
UniProt ID Q9NPZ5
Domains Glyco_transf_43
Protein Families Transmembrane
Protein Pathways Chondroitin sulfate biosynthesis, Heparan sulfate biosynthesis, Metabolic pathways
Gene Summary The product of this gene is a transmembrane protein belonging to the glucuronyltransferase family, and catalyzes the transfer of a beta-1,3 linked glucuronic acid to a terminal galactose in different glycoproteins or glycolipids containing a Gal-beta-1-4GlcNAc or Gal-beta-1-3GlcNAc residue. The encoded protein is involved in the synthesis of the human natural killer-1 (HNK-1) carbohydrate epitope, a sulfated trisaccharide implicated in cellular migration and adhesion in the nervous system. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...