Pancreatic alpha amylase (AMY2A) (NM_000699) Human 3' UTR Clone

CAT#: SC200117

3' UTR clone of amylase alpha 2A (pancreatic) (AMY2A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Pancreatic alpha amylase (AMY2A) (NM_000699) Human 3' UTR Clone
Vector pMirTarget
Synonyms AMY2; PA
ACCN NM_000699
Insert Size 64 bp
Sequence Data
>SC200117 3’UTR clone of NM_000699
The sequence shown below is from the reference sequence of NM_000699. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATTGCAATTCATGCTGAATCTAAATTGTAAAATTTAAAATTAAATGCATGTCCTCAAAACAATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000699.4
Synonyms AMY2; PA
Summary This gene encodes a member of the alpha-amylase family of proteins. Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, catalyzing the first step in digestion of dietary starch and glycogen. This gene and several family members are present in a gene cluster on chromosome 1. This gene encodes an amylase isoenzyme produced by the pancreas. [provided by RefSeq, Jan 2015]
Locus ID 279
MW 2.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...