ADAM22 (NM_004194) Human 3' UTR Clone

CAT#: SC200412

3' UTR clone of ADAM metallopeptidase domain 22 (ADAM22) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ADAM22 (NM_004194) Human 3' UTR Clone
Vector pMirTarget
Synonyms ADAM 22; DEE61; EIEE61; MDC2
ACCN NM_004194
Insert Size 118 bp
Sequence Data
>SC200412 3’UTR clone of NM_004194
The sequence shown below is from the reference sequence of NM_004194. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTAGACCTCGGTCTAATTCAACTGAGTAAGTCTGAACCTCTAATGGAAAAAGGCACTCCAAGGTCCTG
TGCAAATAGTGTCAAAAGTAAATTAAGCAGATAGTCAAAGAACTGTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004194.5
Synonyms ADAM 22; DEE61; EIEE61; MDC2
Summary This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. Unlike other members of the ADAM protein family, the protein encoded by this gene lacks metalloprotease activity since it has no zinc-binding motif. This gene is highly expressed in the brain and may function as an integrin ligand in the brain. In mice, it has been shown to be essential for correct myelination in the peripheral nervous system. Alternative splicing results in several transcript variants.[provided by RefSeq, Dec 2010]
Locus ID 53616
MW 4.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...