KIAA1731 (CEP295) (NM_033395) Human 3' UTR Clone

CAT#: SC200438

3' UTR clone of KIAA1731 (KIAA1731) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name KIAA1731 (CEP295) (NM_033395) Human 3' UTR Clone
Vector pMirTarget
Synonyms KIAA1731
ACCN NM_033395
Insert Size 119 bp
Sequence Data
>SC200438 3’UTR clone of NM_033395
The sequence shown below is from the reference sequence of NM_033395. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGAAACTTCGAGCCAAAAATACATGCTGACTTTCTAGAAATAGTGTAAAGGTTTTTTAATTGTGTATA
TGTAGCATTAGACAAAATTATTTAAAGTCAATAAATTGTTATTCGAGGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033395.2
Synonyms KIAA1731
Summary Centriole-enriched microtubule-binding protein involved in centriole biogenesis (PubMed:20844083, PubMed:25131205, PubMed:27185865). Essential for the generation of the distal portion of new-born centrioles in a CENPJ- and CEP120-mediated elongation dependent manner during the cell cycle S/G2 phase after formation of the initiating cartwheel structure (PubMed:27185865). Required for the recruitment of centriolar proteins, such as POC1B, POC5 and CEP135, into the distal portion of centrioles (PubMed:27185865). Also required for centriole-to-centrosome conversion during mitotic progression, but is dispensable for cartwheel removal or centriole disengagement (PubMed:25131205). Binds to and stabilizes centriolar microtubule (PubMed:27185865).[UniProtKB/Swiss-Prot Function]
Locus ID 85459
MW 4.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...