C1orf41 (HSPB11) (NM_016126) Human 3' UTR Clone

CAT#: SC200475

3' UTR clone of heat shock protein family B (small) member 11 (HSPB11) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name C1orf41 (HSPB11) (NM_016126) Human 3' UTR Clone
Vector pMirTarget
Synonyms C1orf41; FAP232; HSPCO34; IFT25; PP25
ACCN NM_016126
Insert Size 120 bp
Sequence Data
>SC200475 3’UTR clone of NM_016126
The sequence shown below is from the reference sequence of NM_016126. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGAACAGTAGTCTCAAATCTTTCCTCATAATGATAACAAAATGCTCTTGCATGATTTTTTAACAATATA
TTTAAACAGGAAGTTGTCACTGATATACTTTATTAAAAGGATTTTTATCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016126.4
Synonyms C1orf41; FAP232; HSPCO34; IFT25; PP25
Summary Component of the IFT complex B required for sonic hedgehog/SHH signaling. May mediate transport of SHH components: required for the export of SMO and PTCH1 receptors out of the cilium and the accumulation of GLI2 at the ciliary tip in response to activation of the SHH pathway, suggesting it is involved in the dynamic transport of SHH signaling molecules within the cilium. Not required for ciliary assembly. Its role in intraflagellar transport is mainly seen in tissues rich in ciliated cells such as kidney and testis. Essential for male fertility, spermiogenesis and sperm flagella formation. Plays a role in the early development of the kidney. May be involved in the regulation of ureteric bud initiation (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 51668
MW 4.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...