UBC (NM_021009) Human 3' UTR Clone

CAT#: SC200562

3' UTR clone of ubiquitin C (UBC) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name UBC (NM_021009) Human 3' UTR Clone
Vector pMirTarget
Synonyms HMG20
ACCN NM_021009
Insert Size 98 bp
Sequence Data
>SC200562 3’UTR clone of NM_021009
The sequence shown below is from the reference sequence of NM_021009. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGGTCCTGCGCTTGAGGGGGGGTGTCTAAGTTTCCCCTTTTAAGGTTTCAACAAATTTCATTGCACTT
TCCTTTCAATAAAGTTGTTGCATTCCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021009.7
Synonyms HMG20
Summary This gene represents a ubiquitin gene, ubiquitin C. The encoded protein is a polyubiquitin precursor. Conjugation of ubiquitin monomers or polymers can lead to various effects within a cell, depending on the residues to which ubiquitin is conjugated. Ubiquitination has been associated with protein degradation, DNA repair, cell cycle regulation, kinase modification, endocytosis, and regulation of other cell signaling pathways. [provided by RefSeq, Aug 2010]
Locus ID 7316
MW 3.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...