NDUFB8 (NM_005004) Human 3' UTR Clone

CAT#: SC200567

3' UTR clone of NADH dehydrogenase (ubiquinone) 1 beta subcomplex8 19kDa (NDUFB8) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NDUFB8 (NM_005004) Human 3' UTR Clone
Vector pMirTarget
Synonyms ASHI; CI-ASHI; MC1DN32
ACCN NM_005004
Insert Size 127 bp
Sequence Data
>SC200567 3’UTR clone of NM_005004
The sequence shown below is from the reference sequence of NM_005004. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAGAGCGGGTGGTTCACTATGAGATCTGAGGAGGCTTCGTGGGCTTTTGGGTCCTCTAACTAGGACTC
CCTCATTCCTAGAAATTTAACCTTAATGAAATCCCTAATAAAACTCAGTGCTGTGTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005004.4
Synonyms ASHI; CI-ASHI; MC1DN32
Summary Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone.[UniProtKB/Swiss-Prot Function]
Locus ID 4714
MW 4.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...