DAP13 (NDUFA12) (NM_018838) Human 3' UTR Clone

CAT#: SC200725

3' UTR clone of NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 12 (NDUFA12) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name DAP13 (NDUFA12) (NM_018838) Human 3' UTR Clone
Vector pMirTarget
Synonyms B17.2; DAP13; MC1DN23
ACCN NM_018838
Insert Size 137 bp
Sequence Data
>SC200725 3’UTR clone of NM_018838
The sequence shown below is from the reference sequence of NM_018838. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGATCCCACCTTCAACACCTTACAAGTAAAGACAATGAAGAACAGTTGAAACATGCAAAATATGGAGC
TTTTCATGTAATTACTCTTTTACTGTTTACCATTCACTATAATTCACAATTAAAATTGTGTGACTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018838.5
Synonyms B17.2; DAP13; MC1DN23
Summary This gene encodes a protein which is part of mitochondrial complex 1, part of the oxidative phosphorylation system in mitochondria. Complex 1 transfers electrons to ubiquinone from NADH which establishes a proton gradient for the generation of ATP. Mutations in this gene are associated with Leigh syndrome due to mitochondrial complex 1 deficiency. Pseudogenes of this gene are located on chromosomes 5 and 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Locus ID 55967
MW 5.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...