AASDH (NM_181806) Human 3' UTR Clone

CAT#: SC200961

3' UTR clone of aminoadipate-semialdehyde dehydrogenase (AASDH) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name AASDH (NM_181806) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACSF4; LYS2; NRPS998; NRPS1098
ACCN NM_181806
Insert Size 142 bp
Sequence Data
>SC200961 3’UTR clone of NM_181806
The sequence shown below is from the reference sequence of NM_181806. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGATTTATTGGGTGGCAATCAAAAATAATCAAATACAGTCCTTATTTGTATAACAAATGTGAGATAT
TTGAAAATATTTTACCATTATACATCATGTGGACTTATTTTATATTAAAGAAGATTATATTTTGGCTAA
GAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181806.4
Synonyms ACSF4; LYS2; NRPS998; NRPS1098
Summary This gene encodes a member of the non-ribosome peptide syntesase (NRPS) enzyme family. The encoded protein contains an AMP-binding domain, PP-binding (phosphopantetheine, or pantetheine 4'phosphate-binding) domain and the Pyrrolo-quinoline quinon (PQQ) binding domain. The protein is expressed in several adult tissues. [provided by RefSeq, Apr 2016]
Locus ID 132949
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...