TMPRSS3 (NM_032405) Human 3' UTR Clone

CAT#: SC200973

3' UTR clone of transmembrane protease serine 3 (TMPRSS3) transcript variant D for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TMPRSS3 (NM_032405) Human 3' UTR Clone
Vector pMirTarget
Synonyms DFNB8; DFNB10; ECHOS1; TADG12
ACCN NM_032405
Insert Size 136 bp
Sequence Data
>SC200973 3’UTR clone of NM_032405
The sequence shown below is from the reference sequence of NM_032405. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGCAATTGCTCATTGAAGCATTCTTATGATGGCTGCTTTATAATCCTTGTCAGATATTAATAATTCCA
ACTCCTGATTCATGTTGGTGTTGGCATCAGTTGATTATCTTTTCTCATTAAAATTGTGATGCTCCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032405.2
Synonyms DFNB8; DFNB10; ECHOS1; TADG12
Summary This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a serine protease domain, a transmembrane domain, an LDL receptor-like domain, and a scavenger receptor cysteine-rich domain. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified by its association with both congenital and childhood onset autosomal recessive deafness. This gene is expressed in fetal cochlea and many other tissues, and is thought to be involved in the development and maintenance of the inner ear or the contents of the perilymph and endolymph. This gene was also identified as a tumor-associated gene that is overexpressed in ovarian tumors. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Locus ID 64699
MW 5.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...