ANT 1 (PRPF6) (NM_012469) Human 3' UTR Clone

CAT#: SC201011

3' UTR clone of PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) (PRPF6) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ANT 1 (PRPF6) (NM_012469) Human 3' UTR Clone
Vector pMirTarget
Synonyms ANT-1; ANT1; C20orf14; hPrp6; Prp6; RP60; SNRNP102; TOM; U5-102K
ACCN NM_012469
Insert Size 137 bp
Sequence Data
>SC201011 3’UTR clone of NM_012469
The sequence shown below is from the reference sequence of NM_012469. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGGCCGGCCGCATCAAGAACACCTTCTGATTGAGCGGTTGCCATGGCCGGTCTCCGTGGGGCAGGGTT
GGGCCGCATGTGGAAGGGCTCTGAGCTGTGTCCTCCTTCATTAAAAGTTTTTATGTCTCGTGTCAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012469.4
Synonyms ANT-1; ANT1; C20orf14; hPrp6; Prp6; RP60; SNRNP102; TOM; U5-102K
Summary The protein encoded by this gene appears to be involved in pre-mRNA splicing, possibly acting as a bridging factor between U5 and U4/U6 snRNPs in formation of the spliceosome. The encoded protein also can bind androgen receptor, providing a link between transcriptional activation and splicing. [provided by RefSeq, Jul 2008]
Locus ID 24148
MW 4.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...