Transglutaminase 2 (TGM2) (NM_198951) Human 3' UTR Clone

CAT#: SC201122

3' UTR clone of transglutaminase 2 (C polypeptide protein-glutamine-gamma-glutamyltransferase) (TGM2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Transglutaminase 2 (TGM2) (NM_198951) Human 3' UTR Clone
Vector pMirTarget
Synonyms G(h); hTG2; TG(C); TGC; tTG
ACCN NM_198951
Insert Size 168 bp
Sequence Data
>SC201122 3’UTR clone of NM_198951
The sequence shown below is from the reference sequence of NM_198951. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAGCCCTGTGTTCCTGGAGCATTTGTTGACCGCCAACTGACAACATGCTAGGTAGTGACCTAACCACT
TAGCATGTGTGATTTCACCCCACAGACACTTACATGGCGCTGACTCTGGGGCAGGCCCTGTCCTAAGCA
CTTTATAAATATCAACCCACTTAATTCTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_198951.3
Synonyms G(h); hTG2; TG(C); TGC; tTG
Summary Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene acts as a monomer, is induced by retinoic acid, and appears to be involved in apoptosis. Finally, the encoded protein is the autoantigen implicated in celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 7052
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...