HLAF (HLA-F) (NM_018950) Human 3' UTR Clone

CAT#: SC201186

3' UTR clone of major histocompatibility complex class I F (HLA-F) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name HLAF (HLA-F) (NM_018950) Human 3' UTR Clone
Vector pMirTarget
Synonyms CDA12; HLA-5.4; HLA-CDA12; HLAF
ACCN NM_018950
Insert Size 147 bp
Sequence Data
>SC201186 3’UTR clone of NM_018950
The sequence shown below is from the reference sequence of NM_018950. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAGGGAGCTACTCTCAGGCTGCAGTGTGAGACAGCTTCCTTGTGTGGGACTGAGAAGCAAGATATCAA
TGTAGCAGAATTGCACTTGTGCCTCACGAACATACATAAATTTTAAAAATAAAGAATAAAAATATATCT
TTTTATAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018950.3
Synonyms CDA12; HLA-5.4; HLA-CDA12; HLAF
Summary This gene belongs to the HLA class I heavy chain paralogues. It encodes a non-classical heavy chain that forms a heterodimer with a beta-2 microglobulin light chain, with the heavy chain anchored in the membrane. Unlike most other HLA heavy chains, this molecule is localized in the endoplasmic reticulum and Golgi apparatus, with a small amount present at the cell surface in some cell types. It contains a divergent peptide-binding groove, and is thought to bind a restricted subset of peptides for immune presentation. This gene exhibits few polymorphisms. Multiple transcript variants encoding different isoforms have been found for this gene. These variants lack a coding exon found in transcripts from other HLA paralogues due to an altered splice acceptor site, resulting in a shorter cytoplasmic domain. [provided by RefSeq, Jul 2008]
Locus ID 3134
MW 5.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...