Complement C4A (C4A) (NM_007293) Human 3' UTR Clone

CAT#: SC201250

3' UTR clone of complement component 4A (Rodgers blood group) (C4A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Complement C4A (C4A) (NM_007293) Human 3' UTR Clone
Vector pMirTarget
Synonyms C4; C4A2; C4A3; C4A4; C4A6; C4AD; C4S; CO4; CPAMD2; RG
ACCN NM_007293
Insert Size 171 bp
Sequence Data
>SC201250 3’UTR clone of NM_007293
The sequence shown below is from the reference sequence of NM_007293. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGTATGGCACTCAGGGGTGCCAGGTGTGAGGGCTGCCCTCCCACCTCCGCTGGGAGGAACCTGAACCT
GGGAACCATGAAGCTGGAAGCACTGCTGTGTCCGCTTTCATGAACACAGCCTGGGACCAGGGCATATTA
AAGGCTTTTGGCAGCAAAGTGTCAGTGTTGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007293.3
Synonyms C4; C4A2; C4A3; C4A4; C4A6; C4AD; C4S; CO4; CPAMD2; RG
Summary This gene encodes the acidic form of complement factor 4, part of the classical activation pathway. The protein is expressed as a single chain precursor which is proteolytically cleaved into a trimer of alpha, beta, and gamma chains prior to secretion. The trimer provides a surface for interaction between the antigen-antibody complex and other complement components. The alpha chain is cleaved to release C4 anaphylatoxin, an antimicrobial peptide and a mediator of local inflammation. Deficiency of this protein is associated with systemic lupus erythematosus and type I diabetes mellitus. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. Varying haplotypes of this gene cluster exist, such that individuals may have 1, 2, or 3 copies of this gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
Locus ID 720
MW 6.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...