Exosome Component 9 (EXOSC9) (NM_005033) Human 3' UTR Clone

CAT#: SC201651

3' UTR clone of exosome component 9 (EXOSC9) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Exosome Component 9 (EXOSC9) (NM_005033) Human 3' UTR Clone
Vector pMirTarget
Synonyms p5; p6; PCH1D; PM/Scl-75; PMSCL1; RRP45; Rrp45p
ACCN NM_005033
Insert Size 195 bp
Sequence Data
>SC201651 3’UTR clone of NM_005033
The sequence shown below is from the reference sequence of NM_005033. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAAGAAAAAAGAAGAGAGCTGCCAATTAAAGCTAACAGTTGTATATCTGTATATATAACTATTAAAAG
GGATATTTATTCCATTCTGAGAACCCTGGGTATTTTTTATTCACAAATCCATTATAAAATCTAGCAGGA
TTTTAAAAATAGTTTTTTGTTTTTAATGTGCTTTAAAATAATAAACCTTCTGGAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005033.3
Synonyms p5; p6; PCH1D; PM/Scl-75; PMSCL1; RRP45; Rrp45p
Summary This gene encodes a component of the human exosome, a exoribonuclease complex which processes and degrades RNA in the nucleus and cytoplasm. This component may play a role in mRNA degradation and the polymyositis/scleroderma autoantigen complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Locus ID 5393
MW 7.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...