ATP5PF (NM_001003701) Human 3' UTR Clone

CAT#: SC201671

3' UTR clone of ATP synthase H+ transporting mitochondrial F0 complex subunit F6 (ATP5J) nuclear gene encoding mitochondrial protein transcript variant 5



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ATP5PF (NM_001003701) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATP5; ATP5A; ATP5J; ATPM; CF6; F6
ACCN NM_001003701
Insert Size 170 bp
Sequence Data
>SC201671 3’UTR clone of NM_001003701
The sequence shown below is from the reference sequence of NM_001003701. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTGAAGTCATCGAAAAACCCCAGGCCTGAAGAAATAAAGTAAAATTAATCTGGTAATTTGTCACGGAT
TAGTTGTACAACTAGTTAGAAGTTTCAGAATAAACATGCATTTCATAACTGTCAAATGTTCTTTTAATT
CTGAGTCCAAATAAATTATTTGGTGATGTTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001003701.2
Synonyms ATP5; ATP5A; ATP5J; ATPM; CF6; F6
Summary Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo complex has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the F6 subunit of the Fo complex. The F6 subunit is required for F1 and Fo interactions. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has 1 or more pseudogenes. [provided by RefSeq, Feb 2016]
Locus ID 522
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...