MIPEP (NM_005932) Human 3' UTR Clone

CAT#: SC201845

3' UTR clone of mitochondrial intermediate peptidase (MIPEP) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MIPEP (NM_005932) Human 3' UTR Clone
Vector pMirTarget
Synonyms COXPD31; HMIP; MIP
ACCN NM_005932
Insert Size 189 bp
Sequence Data
>SC201845 3’UTR clone of NM_005932
The sequence shown below is from the reference sequence of NM_005932. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCGAAACTTTCCTCATGGATTCTGAATAAAAGAAACACTCTACACCTCTTAAATCAAGGTCATGTAGA
TAATGACTTTGTTATAAATGCTACAGCTGTGAGAGCTTGTTTCTGATTTCATTGTTCGCTTCTGTAATT
CTGAAAAACTTTAAACTGGTAGAACTTGGAATAAATAATTTGTTTTAATTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005932.4
Synonyms COXPD31; HMIP; MIP
Summary The product of this gene performs the final step in processing a specific class of nuclear-encoded proteins targeted to the mitochondrial matrix or inner membrane. This protein is primarily involved in the maturation of oxidative phosphorylation (OXPHOS)-related proteins. This gene may contribute to the functional effects of frataxin deficiency and the clinical manifestations of Friedreich ataxia. [provided by RefSeq, Jul 2008]
Locus ID 4285
MW 7.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...