NUDT6 (NM_198041) Human 3' UTR Clone

CAT#: SC202150

3' UTR clone of nudix (nucleoside diphosphate linked moiety X)-type motif 6 (NUDT6) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NUDT6 (NM_198041) Human 3' UTR Clone
Vector pMirTarget
Synonyms ASFGF2; FGF-AS; FGF2AS; GFG-1; GFG1
ACCN NM_198041
Insert Size 281 bp
Sequence Data
>SC202150 3’UTR clone of NM_198041
The sequence shown below is from the reference sequence of NM_198041. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AATTATAAAACTATGAAAGGAATTGATTAAATTCACATTTATATGTTTAGAAACATGTAGACTAACGAA
TGACATAAGAAATAGTGGACATTTTGGATTGATTAAACATCTGACTGTGATTTTCTAATGTATATGATT
TCCATGAAGAAATTTTGTTTCTAAACATGCACATTTTAAAAGCCTCTTTTCGAATAAAGCAAATGCGTG
AAAAAGATCATTGCTCTAGGTAAGCTTCACTGGGTAACAGCAGATGCAATATAAAAGGGAGAATATACA
TTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_198041.3
Synonyms ASFGF2; FGF-AS; FGF2AS; GFG-1; GFG1
Summary This gene overlaps and lies on the opposite strand from FGF2 gene, and is thought to be the FGF2 antisense gene. The two genes are independently transcribed, and their expression shows an inverse relationship, suggesting that this antisense transcript may regulate FGF2 expression. This gene has also been shown to have hormone-regulatory and antiproliferative actions in the pituitary that are independent of FGF2 expression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Locus ID 11162
MW 11.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...