Carboxypeptidase B (CPB1) (NM_001871) Human 3' UTR Clone

CAT#: SC202151

3' UTR clone of carboxypeptidase B1 (tissue) (CPB1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Carboxypeptidase B (CPB1) (NM_001871) Human 3' UTR Clone
Vector pMirTarget
Synonyms CPB; PASP; PCPB
ACCN NM_001871
Insert Size 215 bp
Sequence Data
>SC202151 3’UTR clone of NM_001871
The sequence shown below is from the reference sequence of NM_001871. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCAGCTACGTCCTGGAACACCTGTACTAGTTGAGAAAGCTGATGGCCTTGTTTCAAAATTCTCATTTT
TCATTTCTTTTCTTTCTTGAATTCTTATTTTGGTTTGCCTGGATGTTTTGCAGATCCCAATCTTTCTTT
TAAGCTTCTGGGTCTATTAAACTAGGTAGATCTTTTCGTATTGATCATAATAAAAGTGAATCATTACTA
TTGGAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001871.3
Synonyms CPB; PASP; PCPB
Summary Three different procarboxypeptidases A and two different procarboxypeptidases B have been isolated. The B1 and B2 forms differ from each other mainly in isoelectric point. Carboxypeptidase B1 is a highly tissue-specific protein and is a useful serum marker for acute pancreatitis and dysfunction of pancreatic transplants. It is not elevated in pancreatic carcinoma. [provided by RefSeq, Jul 2008]
Locus ID 1360
MW 8.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...