UTY (NM_182659) Human 3' UTR Clone

CAT#: SC202307

3' UTR clone of ubiquitously transcribed tetratricopeptide repeat gene Y-linked (UTY) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name UTY (NM_182659) Human 3' UTR Clone
Vector pMirTarget
Synonyms KDM6AL; KDM6C; UTY1
ACCN NM_182659
Insert Size 233 bp
Sequence Data
>SC202307 3’UTR clone of NM_182659
The sequence shown below is from the reference sequence of NM_182659. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATCCAAAGCTTTTTGAAATGATTAAGTAAGTGCCTTCTGAAACTGCTGCAGTTTCTCTTTGGGGGTAT
TGGTAGCCATTCAGTATTTTTTTCAAAAGAATTCTGTTGACATTAAATGATATCAGCAGTCCAGAAGTC
TTGGCAAAATGTAATAAGATGTAAATAATCTTATATATTCATAAGTGTTATAAAATCTCATAAGATTAA
AATATTGCCTTCCCTTAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_182659.1
Synonyms KDM6AL; KDM6C; UTY1
Summary This gene encodes a protein containing tetratricopeptide repeats which are thought to be involved in protein-protein interactions. The encoded protein is also a minor histocompatibility antigen which may induce graft rejection of male stem cell grafts. A large number of alternatively spliced transcripts have been observed for this gene, but the full length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2012]
Locus ID 7404
MW 9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...