MDH1 (NM_005917) Human 3' UTR Clone

CAT#: SC202354

3' UTR clone of malate dehydrogenase 1 NAD (soluble) (MDH1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MDH1 (NM_005917) Human 3' UTR Clone
Vector pMirTarget
Synonyms DEE88; EIEE88; HEL-S-32; KAR; MDH-s; MDHA; MGC:1375; MOR2
ACCN NM_005917
Insert Size 240 bp
Sequence Data
>SC202354 3’UTR clone of NM_005917
The sequence shown below is from the reference sequence of NM_005917. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGTGCTTTTGAATTTCTTTCCTCTGCCTGACTAGACAATGATGTTACTAAATGCTTCAAAGCTGAAGAA
TCTAAATGTCGTCTTTGACTCAAGTACCAAATAATAATAATGCTATACTTAAATTACTTGTGAAAAACA
ACACATTTTAAAGATTACGTGCTTCTTGGTACAGGTTTGTGAATGACAGTTTATCGTCATGCTGTTAGT
GTGCATTCTAAATAAATATATATTCAAATGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005917.4
Synonyms DEE88; EIEE88; HEL-S-32; KAR; MDH-s; MDHA; MGC:1375; MOR2
Summary This gene encodes an enzyme that catalyzes the NAD/NADH-dependent, reversible oxidation of malate to oxaloacetate in many metabolic pathways, including the citric acid cycle. Two main isozymes are known to exist in eukaryotic cells: one is found in the mitochondrial matrix and the other in the cytoplasm. This gene encodes the cytosolic isozyme, which plays a key role in the malate-aspartate shuttle that allows malate to pass through the mitochondrial membrane to be transformed into oxaloacetate for further cellular processes. Alternatively spliced transcript variants have been found for this gene. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Pseudogenes have been identified on chromosomes X and 6. [provided by RefSeq, Feb 2016]
Locus ID 4190
MW 9.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...