PPAR gamma (PPARG) (NM_005037) Human 3' UTR Clone

CAT#: SC202415

3' UTR clone of peroxisome proliferator-activated receptor gamma (PPARG) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PPAR gamma (PPARG) (NM_005037) Human 3' UTR Clone
Vector pMirTarget
Synonyms CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
ACCN NM_005037
Insert Size 229 bp
Sequence Data
>SC202415 3’UTR clone of NM_005037
The sequence shown below is from the reference sequence of NM_005037. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGCAGGAGATCTACAAGGACTTGTACTAGCAGAGAGTCCTGAGCCACTGCCAACATTTCCCTTCTTCC
AGTTGCACTATTCTGAGGGAAAATCTGACACCTAAGAAATTTACTGTGAAAAAGCATTTTAAAAAGAAA
AGGTTTTAGAATATGATCTATTTTATGCATATTGTTTATAAAGACACATTTACAATTTACTTTTAATAT
TAAAAATTACCATATTATGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005037.7
Synonyms CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
Summary This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors. PPARs form heterodimers with retinoid X receptors (RXRs) and these heterodimers regulate transcription of various genes. Three subtypes of PPARs are known: PPAR-alpha, PPAR-delta, and PPAR-gamma. The protein encoded by this gene is PPAR-gamma and is a regulator of adipocyte differentiation. Additionally, PPAR-gamma has been implicated in the pathology of numerous diseases including obesity, diabetes, atherosclerosis and cancer. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
Locus ID 5468
MW 9.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...