TAF9 (NM_003187) Human 3' UTR Clone

CAT#: SC202585

3' UTR clone of TAF9 RNA polymerase II TATA box binding protein (TBP)-associated factor 32kDa (TAF9) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TAF9 (NM_003187) Human 3' UTR Clone
Vector pMirTarget
Synonyms MGC:5067; STAF31/32; TAF2G; TAFII-31; TAFII-32; TAFII31; TAFII32; TAFIID32
ACCN NM_003187
Insert Size 199 bp
Sequence Data
>SC202585 3' UTR clone of NM_003187
The sequence shown below is from the reference sequence of NM_003187. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GATGATGACTATGATAATCTGTAATCTAGCCTTGCTGAATGTAACATGTATACTTGGTCTTGAATTCATT
GTACTGATATTAAACATGCATGCTGGATGTTTTCAAGTTGTGTTTTAGAAAACTAATAATAATGAGTAAA
CACAGTTACCATACTTTTCAATTGAAATGAAGGTTTTTCATCAGCCTTAAAAGTGTAAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003187.4
Synonyms MGC:5067; STAF31/32; TAF2G; TAFII-31; TAFII-32; TAFII31; TAFII32; TAFIID32
Summary Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the smaller subunits of TFIID that binds to the basal transcription factor GTF2B as well as to several transcriptional activators such as p53 and VP16. In human, TAF9 and AK6 (GeneID: 102157402) are two distinct genes that share 5' exons. A similar but distinct gene (TAF9L) has been found on the X chromosome and a pseudogene has been identified on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Locus ID 6880
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...