ALDH1L1 (NM_012190) Human 3' UTR Clone

CAT#: SC202676

3' UTR clone of aldehyde dehydrogenase 1 family member L1 (ALDH1L1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ALDH1L1 (NM_012190) Human 3' UTR Clone
Vector pMirTarget
Synonyms 10-fTHF; 10-FTHFDH; FDH; FTHFD
ACCN NM_012190
Insert Size 251 bp
Sequence Data
>SC202676 3’UTR clone of NM_012190
The sequence shown below is from the reference sequence of NM_012190. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGGGTCAAGACAGTGACCTTCGAATACTGAAGAAAGGTCTTTGTGAGAAGAAAGTCCCTGCCCCTCCCT
CGTGGCTGGGGCCCCCTCCCTCTTGAGCCTGGGTGCACAGCACCTCCCACCTGGGGGGCTAGTGGAAGC
CCTCCTGCCTGCACACCATGTCTGCATCTTGGACGCCCTCTGTCCAGTCAGAAGCAGCCCTTGGCTGGG
TGAGGTGTGCCCCTCCCAGGGAGAATAAAGCTTCTGAAGAGAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012190.4
Synonyms 10-fTHF; 10-FTHFDH; FDH; FTHFD
Summary The protein encoded by this gene catalyzes the conversion of 10-formyltetrahydrofolate, nicotinamide adenine dinucleotide phosphate (NADP+), and water to tetrahydrofolate, NADPH, and carbon dioxide. The encoded protein belongs to the aldehyde dehydrogenase family. Loss of function or expression of this gene is associated with decreased apoptosis, increased cell motility, and cancer progression. There is an antisense transcript that overlaps on the opposite strand with this gene locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Locus ID 10840
MW 9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...