TSG101 (NM_006292) Human 3' UTR Clone

CAT#: SC203096

3' UTR clone of tumor susceptibility gene 101 (TSG101) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TSG101 (NM_006292) Human 3' UTR Clone
Vector pMirTarget
Synonyms TSG10; VPS23
ACCN NM_006292
Insert Size 265 bp
Sequence Data
>SC203096 3’UTR clone of NM_006292
The sequence shown below is from the reference sequence of NM_006292. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGACTGCCGGTCTCAGTGACCTCTACTGACTTCTCTGATACCAGCTGGAGGTTGAGCTCTTCTTAAAG
TATTCTTCTCTTCCTTTTATCAGTAGGTGCCCAGAATAAGTTATTGCAGTTTATCATTCAAGTGTAAAA
TATTTTGAATCAATAATATATTTTCTGTTTTCTTTTGGTAAAGACTGGCTTTTATTAATGCACTTTCTA
TCCTCTGTAAACTTTTTGTGCTGAATGTTGGGACTGCTAAATAAAATTTGTTGCATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006292.4
Synonyms TSG10; VPS23
Summary The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008]
Locus ID 7251
MW 10.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...