PSMB5 (NM_001130725) Human 3' UTR Clone

CAT#: SC203166

3' UTR clone of proteasome (prosome macropain) subunit beta type 5 (PSMB5) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PSMB5 (NM_001130725) Human 3' UTR Clone
Vector pMirTarget
Synonyms LMPX; MB1; X
ACCN NM_001130725
Insert Size 285 bp
Sequence Data
>SC203166 3’UTR clone of NM_001130725
The sequence shown below is from the reference sequence of NM_001130725. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CATGAGAAGTATAGTGGCTCTACCCCCTGAAAGAGGGTGGATGCAGCTGCTTGTGTTTCTTGGGGTGAC
TGTCATTGGTAATACGGACACAGTGACCCATCCTCCATCCTATTTATAGTGGAAGGGCCTTCAATTGTA
TCAGTACTTTTTTTTAAGCTCTGGCACATTGACCTCTATGTGTTACCAGTCATTAATGAGCTGCTGCAG
AGGTGACTATTTGTTTTACTTTCTTGGATGTTAACATTACACTACTCACTACTCAATCTCAAAAAAAAA
AAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001130725.1
Synonyms LMPX; MB1; X
Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Locus ID 5693
MW 11
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...