TREM2 (NM_018965) Human 3' UTR Clone

CAT#: SC203314

3' UTR clone of triggering receptor expressed on myeloid cells 2 (TREM2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TREM2 (NM_018965) Human 3' UTR Clone
Vector pMirTarget
Synonyms PLOSL2; TREM-2; Trem2a; Trem2b; Trem2c
ACCN NM_018965
Insert Size 286 bp
Sequence Data
>SC203314 3’UTR clone of NM_018965
The sequence shown below is from the reference sequence of NM_018965. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAAACTCTGCCAGGGCTGAGAGACACGTGAAGGAAGATGATGGGAGGAAAAGCCCAGGAGAAGTCCCAC
CAGGGACCAGCCCAGCCTGCATACTTGCCACTTGGCCACCAGGACTCCTTGTTCTGCTCTGGCAAGAGA
CTACTCTGCCTGAACACTGCTTCTCCTGGACCCTGGAAGCAGGGACTGGTTGAGGGAGTGGGGAGGTGG
TAAGAACACCTGACAACTTCTGAATATTGGACATTTTAAACACTTACAAATAAATCCAAGACTGTCATA
TTTAGCTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018965.4
Synonyms PLOSL2; TREM-2; Trem2a; Trem2b; Trem2c
Summary This gene encodes a membrane protein that forms a receptor signaling complex with the TYRO protein tyrosine kinase binding protein. The encoded protein functions in immune response and may be involved in chronic inflammation by triggering the production of constitutive inflammatory cytokines. Defects in this gene are a cause of polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (PLOSL). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
Locus ID 54209
MW 10.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...