C4BPA (NM_000715) Human 3' UTR Clone

CAT#: SC203382

3' UTR clone of complement component 4 binding protein alpha (C4BPA) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name C4BPA (NM_000715) Human 3' UTR Clone
Vector pMirTarget
Synonyms C4BP; PRP
ACCN NM_000715
Insert Size 285 bp
Sequence Data
>SC203382 3’UTR clone of NM_000715
The sequence shown below is from the reference sequence of NM_000715. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGACAATCCACTTTGGATAAAGAACTATAATTTTTCTCAAAAGAAGGAGGAAAAGGTGTCTTGCTGGCT
TGCCTCTTGCAATTCAATACAGATCAGTTTAGCAAATCTACTGTCAATTTGGCAGTGATATTCATCATA
ATAAATATCTAGAAATGATAATTTGCTAAAGTTTAGTGCTTTGAGATTGTGAAATTATTAATCATCCTC
TGTGTGGCTCATGTTTTTGCTTTTCAACACACAAAGCACAAATTTTTTTTCGATTAAAAATGTATGTAT
AAAAAACTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000715.4
Synonyms C4BP; PRP
Summary This gene encodes a member of a superfamily of proteins composed predominantly of tandemly arrayed short consensus repeats of approximately 60 amino acids. Along with a single, unique beta-chain, seven identical alpha-chains encoded by this gene assemble into the predominant isoform of C4b-binding protein, a multimeric protein that controls activation of the complement cascade through the classical pathway. The genes encoding both alpha and beta chains are located adjacent to each other on human chromosome 1 in the regulator of complement activation gene cluster. Two pseudogenes of this gene are also found in the cluster. [provided by RefSeq, Jul 2008]
Locus ID 722
MW 11
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...