ALS (IGFALS) (NM_001146006) Human 3' UTR Clone

CAT#: SC203386

3' UTR clone of insulin-like growth factor binding protein acid labile subunit (IGFALS) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ALS (IGFALS) (NM_001146006) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACLSD; ALS
ACCN NM_001146006
Insert Size 217 bp
Sequence Data
>SC203386 3’UTR clone of NM_001146006
The sequence shown below is from the reference sequence of NM_001146006. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCAGCGAGGCCCACTTTGCTCCCTGCTGACCAGGTCCCCGGACTCAAGCCCCGGACTCAGGCCCCCAC
CTGGCTCACCTTGTGCTGGGGACAGGTCCTCAGTGTCCTCAGGGGCCTGCCCAGTGCACTTGCTGGAAG
ACGCAAGGGCCTGATGGGGTGGAAGGCATGGCGGCCCCCCCAGCTGTCATCAATTAAAGGCAAAGGCAA
TCGAATCTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001146006.2
Synonyms ACLSD; ALS
Summary The protein encoded by this gene is a serum protein that binds insulin-like growth factors, increasing their half-life and their vascular localization. Production of the encoded protein, which contains twenty leucine-rich repeats, is stimulated by growth hormone. Defects in this gene are a cause of acid-labile subunit deficiency, which maifests itself in a delayed and slow puberty. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Locus ID 3483
MW 7.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...