TRIM37 (NM_001005207) Human 3' UTR Clone

CAT#: SC203664

3' UTR clone of tripartite motif-containing 37 (TRIM37) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TRIM37 (NM_001005207) Human 3' UTR Clone
Vector pMirTarget
Synonyms MUL; POB1; TEF3
ACCN NM_001005207
Insert Size 299 bp
Sequence Data
>SC203664 3’UTR clone of NM_001005207
The sequence shown below is from the reference sequence of NM_001005207. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCAATACAGATGAAAATAGTGGAAGATAATTTGATTTGAAACTGACACTGCACCTGATGGGTTAACAA
GATCTAGGCTTCAGAAGGTGACAGATATGAGTGAGGACCATGTGTGGGGCAAAGCCTCAGAATGATGAA
AAGGTTCCGGCACTATAGTTGGGGCCATGTTGACTCCTTTTCAACCATTTGTCACAGACGTGAGAAGAA
GAAATGACTTCAAAATCAAGAGAAAACAAATACTGAAAGTCTCTACTTACATCCAAATTTTAAAAAATA
AAATCTGTAGATTAACAATCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001005207.5
Synonyms MUL; POB1; TEF3
Summary This gene encodes a member of the tripartite motif (TRIM) family, whose members are involved in diverse cellular functions such as developmental patterning and oncogenesis. The TRIM motif includes zinc-binding domains, a RING finger region, a B-box motif and a coiled-coil domain. The RING finger and B-box domains chelate zinc and might be involved in protein-protein and/or protein-nucleic acid interactions. Mutations in this gene are associated with mulibrey (muscle-liver-brain-eye) nanism, an autosomal recessive disorder that involves several tissues of mesodermal origin. TRIM37 localizes in peroxisomal membranes, and has been implicated in human peroxisomal biogenesis disorders. [provided by RefSeq, Jul 2020]
Locus ID 4591
MW 11.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...