Dystrobrevin alpha (DTNA) (NM_001392) Human 3' UTR Clone

CAT#: SC203714

3' UTR clone of dystrobrevin alpha (DTNA) transcript variant 7 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Dystrobrevin alpha (DTNA) (NM_001392) Human 3' UTR Clone
Vector pMirTarget
Synonyms D18S892E; DRP3; DTN; DTN-A; LVNC1
ACCN NM_001392
Insert Size 283 bp
Sequence Data
>SC203714 3’UTR clone of NM_001392
The sequence shown below is from the reference sequence of NM_001392. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCGGACGGTGCTTTTGGTGGATGCGTCTAGATGGATAACATGACTTCTTCTACCCTAAAATATTCCTAT
AATACTTTGAGCTGTTCTGGTTCCTCCAGGGTGCATGGTACCCATTAACCCAAAATATGATTATTTCCC
TTTTTTCCCATTTTCAGTCATTTTGGAATGTTCTCTGTGAACCACAGTTGTGTTGTTTAAAGCTCACAT
TTCTTTCTGTCACCACAGAGATTGGCCTACGGTTTCTGTTTTGAGGGTGCTGTTCAATAAAGCTGTGTA
CACTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001392.5
Synonyms D18S892E; DRP3; DTN; DTN-A; LVNC1
Summary The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Locus ID 1837
MW 10.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...