HTR2B (NM_000867) Human 3' UTR Clone

CAT#: SC203738

3' UTR clone of 5-hydroxytryptamine (serotonin) receptor 2B (HTR2B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name HTR2B (NM_000867) Human 3' UTR Clone
Vector pMirTarget
Synonyms 5-HT(2B); 5-HT-2B; 5-HT2B
ACCN NM_000867
Insert Size 317 bp
Sequence Data
>SC203738 3’UTR clone of NM_000867
The sequence shown below is from the reference sequence of NM_000867. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAACTGAAGAGCAAGTTAGTTATGTATAGCAGAACTGGCAGTTGTCATCAAACATAATGATGAGTAAG
ATGATGAATGAGATGTAAATGTGCCAAGAATATATTATATAAAGAATTTTATGTCATATATCAAATCAT
CTCTTTAACCTAAGATGTAAGTATTAAGAATATCTAATTTTCCTAATTTGGACAAGATTATTCCATGAG
GAAAATAATTTTATATAGCTACAAATGAAAACAATCCAGCACTCTGGTTAAATTTTAAGGTATTCGAAT
GAAATAAAGTCAAATCAATAAATTTCAGGCTTTAAAAAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000867.5
Synonyms 5-HT(2B); 5-HT-2B; 5-HT2B
Summary This gene encodes one of the several different receptors for 5-hydroxytryptamine (serotonin) that belongs to the G-protein coupled receptor 1 family. Serotonin is a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. Serotonin receptors mediate many of the central and peripheral physiologic functions of serotonin, including regulation of cardiovascular functions and impulsive behavior. Population and family-based analyses of a minor allele (glutamine-to-stop substitution, designated Q20*) which blocks expression of this protein, and knockout studies in mice, suggest a role for this gene in impulsivity. However, other factors, such as elevated testosterone levels, may also be involved. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]
Locus ID 3357
MW 12.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...