SPHK1 (NM_001142602) Human 3' UTR Clone

CAT#: SC203801

3' UTR clone of sphingosine kinase 1 (SPHK1) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SPHK1 (NM_001142602) Human 3' UTR Clone
Vector pMirTarget
Synonyms SPHK
ACCN NM_001142602
Insert Size 299 bp
Sequence Data
>SC203801 3’UTR clone of NM_001142602
The sequence shown below is from the reference sequence of NM_001142602. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGATGCCACCGCCAGAAGAGCCCTTATGACCCCTGGGCCGCGCTGTGCCTTAGTGTCTACTTGCAGGA
CCCTTCCTCCTTCCCTAGGGCTGCAGGGCCTGTCCACAGCTCCTGTGGGGGTGGAGGAGACTCCTCTGG
AGAAGGGTGAGAAGGTGGAGGCTATGCTTTGGGGGGACAGGCCAGAATGAAGTCCTGGGTCAGGAGCCC
AGCTGGCTGGGCCCAGCTGCCTATGTAAGGCCTTCTAGTTTGTTCTGAGACCCCCACCCCACGAACCAA
ATCCAAATAAAGTGACATTCCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001142602.2
Synonyms SPHK
Summary The protein encoded by this gene catalyzes the phosphorylation of sphingosine to form sphingosine-1-phosphate (S1P), a lipid mediator with both intra- and extracellular functions. Intracellularly, S1P regulates proliferation and survival, and extracellularly, it is a ligand for cell surface G protein-coupled receptors. This protein, and its product S1P, play a key role in TNF-alpha signaling and the NF-kappa-B activation pathway important in inflammatory, antiapoptotic, and immune processes. Phosphorylation of this protein alters its catalytic activity and promotes its translocation to the plasma membrane. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2017]
Locus ID 8877
MW 11.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...