DYNLL1 (NM_001037494) Human 3' UTR Clone

CAT#: SC203864

3' UTR clone of dynein light chain LC8-type 1 (DYNLL1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name DYNLL1 (NM_001037494) Human 3' UTR Clone
Vector pMirTarget
Synonyms DLC1; DLC8; DNCL1; DNCLC1; hdlc1; LC8; LC8a; PIN
ACCN NM_001037494
Insert Size 313 bp
Sequence Data
>SC203864 3’UTR clone of NM_001037494
The sequence shown below is from the reference sequence of NM_001037494. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGGCCATTCTTCTGTTCAAATCTGGTTAAAAGCATGGACTGTGCCACACACCCAGTGATCCATCCAAA
AACAAGGACTGCAGCCTAAATTCCAAATACCAGAGACTGAAATTTTCAGCCTTGCTAAGGGAACATCTC
GATGTTTGAACCTTTGTTGTGTTTTGTACAGGGCATTCTCTGTACTAGTTTGTCGTGGTTATAAAACAA
TTAGCAGAATAGCCTACATTTGTATTTATTTTCTATTCCATACTTCTGCCCACGTTGTTTTCTCTCAAA
ATCCATTCCTTTAAAAAATAAATCTGATGCAGATGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001037494.2
Synonyms DLC1; DLC8; DNCL1; DNCLC1; hdlc1; LC8; LC8a; PIN
Summary Cytoplasmic dyneins are large enzyme complexes with a molecular mass of about 1,200 kD. They contain two force-producing heads formed primarily from dynein heavy chains, and stalks linking the heads to a basal domain, which contains a varying number of accessory intermediate chains. The complex is involved in intracellular transport and motility. The protein described in this record is a light chain and exists as part of this complex but also physically interacts with and inhibits the activity of neuronal nitric oxide synthase. Binding of this protein destabilizes the neuronal nitric oxide synthase dimer, a conformation necessary for activity, and it may regulate numerous biologic processes through its effects on nitric oxide synthase activity. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Locus ID 8655
MW 11.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...