Prostate Specific Antigen (KLK3) (NM_001030050) Human 3' UTR Clone

CAT#: SC203983

3' UTR clone of kallikrein-related peptidase 3 (KLK3) transcript variant 6 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Prostate Specific Antigen (KLK3) (NM_001030050) Human 3' UTR Clone
Vector pMirTarget
Synonyms APS; hK3; KLK2A1; PSA
ACCN NM_001030050
Insert Size 334 bp
Sequence Data
>SC203983 3’UTR clone of NM_001030050
The sequence shown below is from the reference sequence of NM_001030050. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCACAGCTGCCCACTGCATCAGGAAGTGAGTAGGGGCCTGGGGTCTGGGGAGCAGGTGTCTGTGTCCC
AGAGGAATAACAGCTGGGCATTTTCCCCAGGATAACCTCTAAGGCCAGCCTTGGGACTGGGGGAGAGAG
GGAAAGTTCTGGTTCAGGTCACATGGGGAGGCAGGGTTGGGGCTGGACCACCCTCCCCATGGCTGCCTG
GGTCTCCATCTGTGTTCCTCTATGTCTCTTTGTGTCGCTTTCATTATGTCTCTTGGTAACTGGCTTCGG
TTGTGTCTCTCCGTGTGACTATTTTGTTCTCTCTCTCCCTCTCTTCTCTGTCTTCAGT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001030050.1
Synonyms APS; hK3; KLK2A1; PSA
Summary Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. The gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. It encodes a single-chain glycoprotein, a protease which is synthesized in the epithelial cells of the prostate gland, and is present in seminal plasma. It is thought to function normally in the liquefaction of seminal coagulum, presumably by hydrolysis of the high molecular mass seminal vesicle protein. The serum level of this protein, called PSA in the clinical setting, is useful in the diagnosis and monitoring of prostatic carcinoma. Alternate splicing of this gene generates several transcript variants encoding different isoforms. [provided by RefSeq, Dec 2019]
Locus ID 354
MW 12.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

其它Prostate Specific Antigen产品

Customer Reviews 
Loading...