BMP4 (NM_001202) Human 3' UTR Clone

CAT#: SC204085

3' UTR clone of bone morphogenetic protein 4 (BMP4) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name BMP4 (NM_001202) Human 3' UTR Clone
Vector pMirTarget
Synonyms BMP2B; BMP2B1; MCOPS6; OFC11; ZYME
ACCN NM_001202
Insert Size 326 bp
Sequence Data
>SC204085 3’UTR clone of NM_001202
The sequence shown below is from the reference sequence of NM_001202. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGGTAGTAGAGGGATGTGGGTGCCGCTGAGATCAGGCAGTCCTTGAGGATAGACAGATATACACACCA
CACACACACACCACATACACCACACACACACGTTCCCATCCACTCACCCACACACTACACAGACTGCTT
CCTTATAGCTGGACTTTTATTTAAAAAAAAAAAAAAAAAAGGAAAAAATCCCTAAACATTCACCTTGAC
CTTATTTATGACTTTACGTGCAAATGTTTTGACCATATTGATCATATATTTTGACAAAATATATTTATA
ACTACGTATTAAAAGAAAAAAATAAAATGAGTCATTATTTTAAAGGTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001202.6
Synonyms BMP2B; BMP2B1; MCOPS6; OFC11; ZYME
Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Mutations in this gene are associated with orofacial cleft and microphthalmia in human patients. The encoded protein may also be involved in the pathology of multiple cardiovascular diseases and human cancers. [provided by RefSeq, Jul 2016]
Locus ID 652
MW 12.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...