KCNK4 (NM_033310) Human 3' UTR Clone

CAT#: SC204142

3' UTR clone of potassium channel subfamily K member 4 (KCNK4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name KCNK4 (NM_033310) Human 3' UTR Clone
Vector pMirTarget
Synonyms FHEIG; K2p4.1; TRAAK; TRAAK1
ACCN NM_033310
Insert Size 335 bp
Sequence Data
>SC204142 3’UTR clone of NM_033310
The sequence shown below is from the reference sequence of NM_033310. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGTCCCCGAGACAAAGGCGTGCCGGTGTAGGGGCAGGATCCCTGGCCGGGCCTCTCAAGGGCTTCGTTT
CTGCTCTCCCCGGCATGCCTGGCTTGTTTGACCAAAGAGCCCTCTTTCCACGAGACTGAAGTCTGGGGA
GGAGGCTACAGTTGCCTCTCCGCCTCCTCCCTGGCCCCGGCCCTTCCCTCACTTCCATCCATCTCTAGA
CCCCCCCAAGGCTTTCTGTGTCGCTGCCCCGGGCGGGTGTATCCCTCACAGCACCTCACGACTGTGCCT
CAAAGCCTGCATCAATAAATGAAAACGGTCTGCACCGCTGCGGGCGTGACGCTCCCGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033310.3
Synonyms FHEIG; K2p4.1; TRAAK; TRAAK1
Summary This gene encodes a member of the TWIK-related arachidonic acid-stimulated two pore potassium channel subfamily. The encoded protein homodimerizes and functions as an outwardly rectifying channel. This channel is regulated by polyunsaturated fatty acids, temperature and mechanical deformation of the lipid membrane. This protein is expressed primarily in neural tissues and may be involved in regulating the noxious input threshold in dorsal root ganglia neurons. Alternate splicing results in multiple transcript variants. Naturally occurring read-through transcripts also exist between this gene and the downstream testis expressed 40 (TEX40) gene, as represented in GeneID: 106780802. [provided by RefSeq, Nov 2015]
Locus ID 50801
MW 11.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...