katanin p80 (KATNB1) (NM_005886) Human 3' UTR Clone

CAT#: SC204214

3' UTR clone of katanin p80 (WD repeat containing) subunit B 1 (KATNB1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name katanin p80 (KATNB1) (NM_005886) Human 3' UTR Clone
Vector pMirTarget
Synonyms KAT; LIS6
ACCN NM_005886
Insert Size 328 bp
Sequence Data
>SC204214 3’UTR clone of NM_005886
The sequence shown below is from the reference sequence of NM_005886. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGCACCTGCTCATGGCCAGTCTGGACTGAGGAAAGCAGTGGGCAGGGGCGCTCGGCAGCCCACAGGGC
CTGGCCTCAGCCCCCACTCCTGTTCCTTGTGCACCCACTGGCCCATGAGCCTCTGCCTGGCCCCTGCTG
CTGTCCTGTGGCCGTCCTGGAGGAGGTGATGCTGGTCCCTGGCCACCTCTACAGCCCTGAACTCTTGAG
ACAACTCTCTCCAGCAATAGCTGCCCAGCTTTGCCCAACTGTTGCTTCTTGGGGCAGCGAACTGAGCCC
TGGGGCTGCTGCTGTAATTTATAAGGCAAATTTTATTAAATTTGTAACTATT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005886.3
Synonyms KAT; LIS6
Summary Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. Katanin is a member of the AAA family of ATPases. [provided by RefSeq, Jul 2008]
Locus ID 10300
MW 11.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...