AP3B2 (NM_004644) Human 3' UTR Clone

CAT#: SC204235

3' UTR clone of adaptor-related protein complex 3 beta 2 subunit (AP3B2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name AP3B2 (NM_004644) Human 3' UTR Clone
Vector pMirTarget
Synonyms DEE48; EIEE48; NAPTB
ACCN NM_004644
Insert Size 309 bp
Sequence Data
>SC204235 3’UTR clone of NM_004644
The sequence shown below is from the reference sequence of NM_004644. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGGATGTGATACAGGCTCTGACCCAGTGACTTCCAAATGCTGTGACCTGTTTGGCTCCCATCTATACC
TCCCCATGACACCTAGGCTGTCAGTCTCTCTCATCTTTCTCTCTCTCTCTCATCATCCTCCTCATGCCA
GATAGCATTCAGGGTGTCCTCTCTCCCTCTGGAGGACCAAGCCCTCCCCTAATGCCCTCCCCATGGATT
CCTTAGTGATCTGTGCAGAGAGAGATGGCAGCCACTCCCTTCAGTCCTCCCAGATTTCTGTAGCTATTT
ATGTAGCAGGCTCAATAAAATGTCTTCTCTCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004644.5
Synonyms DEE48; EIEE48; NAPTB
Summary Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
Locus ID 8120
MW 11.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...