DNAJC7 (NM_003315) Human 3' UTR Clone

CAT#: SC204392

3' UTR clone of DnaJ (Hsp40) homolog subfamily C member 7 (DNAJC7) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name DNAJC7 (NM_003315) Human 3' UTR Clone
Vector pMirTarget
Synonyms DJ11; DJC7; TPR2; TTC2
ACCN NM_003315
Insert Size 328 bp
Sequence Data
>SC204392 3’UTR clone of NM_003315
The sequence shown below is from the reference sequence of NM_003315. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAGGGAATTTCTTTTTTCAATTTGGCTAATGAAGGGCAACCACCCAGAACCCAGAAAATGCAGATTCA
CTCAGTTTAATCTTGAATGTGGAAACAGTTCACCTCCTCCCTTCATCACGTCTCCGTGTGCTTAGAGCA
GTTTCGTTTTCTCAGTTGGATGCCCTGTGTCTCTGTGAGTGGGGTGGAGCAAAGGGAACCAATGCCGAA
GACCGAGGGCAGGGGAGGGAGGCGGGGGTGGACAGGGAGGCAGCTTGTGAATTTTTGTTTTACTGTTTA
ACTTTATTAAAAAAGAAAAAAAAAAGAGAATAAAATGTTTTGACCCTTCCTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003315.4
Synonyms DJ11; DJC7; TPR2; TTC2
Summary This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the chaperone proteins heat shock proteins 70 and 90 in an ATP-dependent manner and may function as a co-chaperone. Pseudogenes of this gene are found on chromosomes 1 and 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Locus ID 7266
MW 12.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...