APOBEC3G (NM_021822) Human 3' UTR Clone

CAT#: SC204401

3' UTR clone of apolipoprotein B editing enzyme catalytic polypeptide-like 3G (APOBEC3G) mRNA for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name APOBEC3G (NM_021822) Human 3' UTR Clone
Vector pMirTarget
Synonyms A3G; ARCD; ARP-9; ARP9; bK150C2.7; CEM-15; CEM15; dJ494G10.1; MDS019
ACCN NM_021822
Insert Size 352 bp
Sequence Data
>SC204401 3’UTR clone of NM_021822
The sequence shown below is from the reference sequence of NM_021822. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGGGCCATTCTCCAGAATCAGGAAAACTGAAGGATGGGCCTCAGTCTCTAAGGAAGGCAGAGACCTGGG
TTGAGCCTCAGAATAAAAGATCTTCTTCCAAGAAATGCAAACAGGCTGTTCACCACCATCTCCAGCTGA
TCACAGACACCAGCAAAGCAATGCACTCCTGACCAAGTAGATTCTTTTAAAAATTAGAGTGCATTACTT
TGAATCAAAAATTTATTTATATTTCAAGAATAAAGTACTAAGATTGTGCTCAATACACAGAAAAGTTTC
AAACCTACTAATCCAGCGACAATTTGAATCGGTTTTGTAGGTAGAGGAATAAAATGAAATACTAAATCT
TTCTGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021822.4
Synonyms A3G; ARCD; ARP-9; ARP9; bK150C2.7; CEM-15; CEM15; dJ494G10.1; MDS019
Summary This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. The protein encoded by this gene catalyzes site-specific deamination of both RNA and single-stranded DNA. The encoded protein has been found to be a specific inhibitor of human immunodeficiency virus-1 (HIV-1) infectivity. [provided by RefSeq, Mar 2017]
Locus ID 60489
MW 13.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...